ov.synbio II — circuits, CRISPR, assembly & pathway design#
The first tutorial covered the metabolism ↔ protein ↔ DNA core. This one tours the rest of the design-build-test-learn cycle that ov.synbio now supports — the parts of synthetic biology a metabolic/protein toolkit alone doesn’t reach:
Genetic circuits & regulation — build gene circuits and simulate them (ODE + stochastic), predict RBS / promoter strength, fold RNA
CRISPR & genome editing — design and score guide RNAs, base-editing windows, HDR donors
DNA assembly — Golden Gate / Gibson construction, restriction maps, GenBank annotation
Pathway design — reaction thermodynamics (MDF), retrosynthesis over a genome-scale model
Library design — degenerate codons, saturation & DMS libraries
Everything here is CPU-only (COBRApy, scipy, ViennaRNA, Biopython, optlang). pip install 'omicverse[synbio]'.
import omicverse as ov
ov.plot_set()
print('omicverse', ov.__version__)
🔬 Starting plot initialization...
🧬 Detecting GPU devices…
✅ NVIDIA CUDA GPUs detected: 1
• [CUDA 0] NVIDIA H100 80GB HBM3
Memory: 79.1 GB | Compute: 9.0
____ _ _ __
/ __ \____ ___ (_)___| | / /__ _____________
/ / / / __ `__ \/ / ___/ | / / _ \/ ___/ ___/ _ \
/ /_/ / / / / / / / /__ | |/ / __/ / (__ ) __/
\____/_/ /_/ /_/_/\___/ |___/\___/_/ /____/\___/
🔖 Version: 2.2.1rc1 📚 Tutorials: https://omicverse.readthedocs.io/
✅ plot_set complete.
omicverse 2.2.1rc1
1 — Genetic circuits#
genetic_circuit builds a gene-regulatory network from a template (or from parts). simulate_circuit integrates it — deterministically (ODEs, Hill kinetics) or stochastically (Gillespie SSA). Start with the Gardner toggle switch: two mutually repressing genes give a bistable system that latches into one state.
toggle = ov.synbio.genetic_circuit('toggle_switch')
df = ov.synbio.simulate_circuit(toggle, t_end=100, method='ode')
ov.synbio.plot_circuit(df, title='toggle switch (bistable)')
None
The Elowitz repressilator — three repressors in a ring (A ⊣ B ⊣ C ⊣ A) — has an unstable fixed point and oscillates. This is the canonical synthetic oscillator.
rep = ov.synbio.genetic_circuit('repressilator')
ov.synbio.plot_circuit(ov.synbio.simulate_circuit(rep, t_end=300), title='repressilator (oscillator)')
None
Stochastic simulation captures the molecular noise that makes small circuits behave probabilistically — the same toggle, run as a Gillespie SSA:
ov.synbio.plot_circuit(ov.synbio.simulate_circuit(toggle, t_end=100, method='stochastic'),
title='toggle switch (stochastic / Gillespie)')
None
1.1 — Regulatory-element strength#
Before a circuit works you must tune its parts. rbs_strength predicts a translation-initiation rate from a 5’UTR (Shine–Dalgarno : anti-SD hybridisation minus the mRNA-unfolding cost, via ViennaRNA); promoter_strength scores a σ70 promoter’s −10/−35 boxes.
strong = ov.synbio.rbs_strength('AAAGAGGAGAAATACTAGATGAAACGT') # consensus SD
weak = ov.synbio.rbs_strength('AAACTCTCTAAATACTAGATGAAACGT') # no SD
print('strong RBS rate:', round(strong.initiation_rate, 1))
print('weak RBS rate:', round(weak.initiation_rate, 1))
ov.synbio.promoter_strength('AACGATTTGACATGCTAGCTATAATGGCACG')
strong RBS rate: 6003.9
weak RBS rate: 20.7
{'strength': 0.3333333333333333,
'minus35': 'ACGATT',
'minus10': 'TGGCAC',
'spacer': 17,
'score35': 0.3333333333333333,
'score10': 0.3333333333333333}
Compare algorithms. The RBS strength above uses method='thermodynamic' (a transparent SD:anti-SD baseline). method='ostir' runs OSTIR, the open-source reimplementation of the Salis RBS Calculator v2 — a real, published translation-initiation-rate predictor. Both agree that the strong-SD construct is far stronger; OSTIR reports calibrated TIR units.
strong='AAAGAGGAGAAATACTAGATGAAACGTATTGCACGT'; weakrbs='AAACTCTCTAAATACTAGATGAAACGTATTGCACGT'
for nm,s in [('strong SD',strong),('weak SD',weakrbs)]:
b=ov.synbio.rbs_strength(s, method='thermodynamic').initiation_rate
o=ov.synbio.rbs_strength(s, method='ostir').initiation_rate
print(f'{nm:10s} thermodynamic={b:9.0f} OSTIR(RBS Calculator)={o:9.0f}')
strong SD thermodynamic= 3828 OSTIR(RBS Calculator)= 107603
weak SD thermodynamic= 21 OSTIR(RBS Calculator)= 981
2 — CRISPR guide design#
design_grnas scans both strands for PAM sites (SpCas9 NGG here), extracts protospacers, and ranks them by an efficiency heuristic. offtarget_search then scores near-matches with a seed-weighted (CFD-style) model.
locus = 'ATGGCACGTGGATCCGGACATGCACCGGTTAACGGGACCGGTTAACCGGTACCGGTTGCACCATGAAA' * 2
guides = ov.synbio.design_grnas(locus, enzyme='SpCas9')
print(f'{len(guides)} guides; best:', guides[0])
offs = ov.synbio.offtarget_search(guides[0].spacer, locus)
print('off-target hits:', len(offs), '| top CFD:', round(offs[0].cfd, 3))
23 guides; best: Guide(TGCACCATGAAAATGGCACG TGG +@56 GC=0.50 eff=1.00)
off-target hits: 1 | top CFD: 1.0
plot_grna_efficiency maps the candidate guides along the target — position vs on-target efficiency, coloured by strand, sized by GC — so you can see where the good guides cluster.
Plan an edit: a base-editor window (ABE, A→G) and HDR homology arms for a knock-in donor.
print(ov.synbio.base_editor_window(guides[0].spacer, editor='ABE'))
donor = ov.synbio.hdr_arms(locus, cut_site=40, arm_length=20, insert='ATGTAG')
print('HDR donor:', donor['left_len'], '+ insert +', donor['right_len'], 'bp')
{'editor': 'ABE', 'window': (4, 8), 'target_base': 'A', 'n_edits': 2, 'edits': [{'position': 4, 'from': 'A', 'to': 'G'}, {'position': 7, 'from': 'A', 'to': 'G'}], 'edited_spacer': 'TGCGCCGTGAAAATGGCACG'}
HDR donor: 20 + insert + 20 bp
3 — DNA assembly#
golden_gate simulates Type IIS (BsaI) assembly: it reads each fragment’s 4-nt fusion overhangs and orders them into a circular construct. restriction_map and annotate_construct help you read the result.
def frag(left, insert, right):
return 'TTGGTCTCA' + left + insert + right + 'AGAGACCTT' # BsaI site .. overhang
res = ov.synbio.golden_gate([frag('AATG', 'CCCCCCCC', 'GTTA'),
frag('GTTA', 'GGGGGGGG', 'AATG')], enzyme='BsaI')
print(res, '| junction overhangs:', res.junctions)
ov.synbio.restriction_map('GAATTCGGATCCAAGCTTGGTACC', enzymes=['EcoRI', 'BamHI', 'HindIII'])
AssemblyResult(GoldenGate/BsaI, 2 fragments -> 24 bp, circular=True) | junction overhangs: ['AATG', 'GTTA']
{'EcoRI': [2], 'BamHI': [8], 'HindIII': [14]}
4 — Pathway design: thermodynamics & retrosynthesis#
A designed pathway must be thermodynamically feasible. max_min_driving_force (MDF) optimises metabolite concentrations to maximise the driving force of the weakest step — a positive MDF means the route can run; the limiting reaction is the bottleneck.
reactions = {'pgi': {'g6p': -1, 'f6p': 1},
'pfk': {'f6p': -1, 'atp': -1, 'fdp': 1, 'adp': 1, 'h': 1}}
dg0 = {r: ov.synbio.reaction_dg(s) for r, s in reactions.items()}
mdf = ov.synbio.max_min_driving_force(reactions, dg0, fixed={'h': 1e-7, 'h2o': 1})
print('MDF =', round(mdf.mdf, 2), 'kJ/mol | feasible:', mdf.feasible,
'| bottleneck:', mdf.bottleneck)
MDF = 20.65 kJ/mol | feasible: True | bottleneck: pgi
Compare algorithms. The MDF above used reaction_dg(method='baseline') (a small built-in ΔGf table). method='equilibrator' runs the real eQuilibrator component-contribution method (Noor 2013; Beber 2022) — the field-standard reaction-thermodynamics tool (first use downloads a ~2 GB cache).
# reaction ΔG'°: built-in baseline table vs REAL eQuilibrator — side by side
labels, base, equi = [], [], []
for r, s in reactions.items():
b = ov.synbio.reaction_dg(s, method='baseline')
e = ov.synbio.reaction_dg(s, method='equilibrator') # component-contribution (Noor 2013)
print(f" {r:4s} baseline={b:9.2f} eQuilibrator(real)={e:9.2f} kJ/mol")
labels.append(r); base.append(b); equi.append(e)
ov.synbio.plot_method_comparison(labels, {'baseline': base, 'eQuilibrator (real)': equi},
ylabel="ΔG'° (kJ/mol)", title='reaction_dg: baseline vs eQuilibrator')
None
plot_driving_forces shows why: the driving force of every step, with the MDF as a line and the bottleneck reaction in red — the one to engineer (a better enzyme, or shifted concentrations) if the pathway stalls.
pathway_search does retrosynthesis within a genome-scale model — the shortest routes that produce a target metabolite (which enzymes to express).
m = ov.synbio.load_gem('e_coli_core')
paths = ov.synbio.pathway_search(m, 'succ_c', max_depth=5, max_paths=3)
for p in paths:
print(f'{p.length} steps:', p.reactions)
1 steps: ['SUCCt2_2']
2 steps: ['FRD7', 'FUMt2_2']
3 steps: ['SUCOAS', 'AKGDH', 'AKGt2r']
5 — Library design#
To test variants you design libraries. degenerate_codon finds the minimal IUPAC codon covering a target amino-acid set (all 20 → NNK/NNS), and saturation_library / dms_library size the screen.
print('all 20 AA ->', ov.synbio.degenerate_codon(list('ACDEFGHIKLMNPQRSTVWY')))
print('aromatics ->', ov.synbio.degenerate_codon(['F', 'Y', 'W']))
print('NNK x3 site-saturation:', ov.synbio.saturation_library(3, 'NNK'))
all 20 AA -> DegenerateCodon(NNS: 32 codons -> 20 AA, missing=[])
aromatics -> DegenerateCodon(TDS: 6 codons -> 5 AA, missing=[])
NNK x3 site-saturation: {'scheme': 'NNK', 'positions': 3, 'codons_per_site': 32, 'aa_per_site': 20, 'stop_fraction_per_site': 0.031, 'dna_diversity': 32768, 'protein_diversity': 8000, 'screen_for_95pct': 98304}
# visualise the codon composition of an NNK site-saturation library as a DNA sequence logo
import itertools
iupac = {'N': 'ACGT', 'K': 'GT'}
nnk = [''.join(c) for c in itertools.product(iupac['N'], iupac['N'], iupac['K'])]
ov.synbio.plot_sequence_logo(nnk, title='NNK codon library (32 codons, 20 AA)')
None
Summary#
Together with the core tutorial, ov.synbio now spans the full design-build-test-learn cycle: metabolic modelling, enzyme design, genetic-circuit design & simulation, regulatory-element engineering, CRISPR editing, DNA assembly, pathway thermodynamics & retrosynthesis, and library design — all AnnData-independent, registered under synthetic_biology, and gated so import omicverse never needs the extra.
For model-guided directed evolution that combines this with the protein layer, see ov.synbio.ml_guided_design, which scores single mutations with ESM and greedily builds multi-mutant designs.